Arsenic AND mercury gate (dual heavy-metal)

A two-input AND gate that fires only when BOTH arsenic and mercury are present — reducing false positives and flagging co-contaminated water. ArsR drives the sgRNA and MerR drives dCas9, so CRISPRi repression (and the readout) needs both metals.

Environmental contaminantAND circuitBSL-1 chassistemplatearsenicmercuryheavy-metalAND-gatemulti-inputwaterenvironmentalCRISPRi

Open in designer Design guide RNA

Input

Arsenite As(III)

Environmental contaminant

→

Sense

CRISPRi-repression

dCas9 (S. pyogenes, catalytically dead)

→

Chassis

E. coli K-12 (MG1655)

BSL-1

→

Output

amilCP

pigment

What it detects

AND design — fires only when all inputs are present.

Input 1: Arsenite As(III) — ArsR ~10 µg/L+
Input 2: Mercuric ion Hg(II) — MerR sub-µM+
Category: Environmental contaminant
Signal: Arsenic (input 1 of 2)

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRi-repression · AND logic
Cas protein: dCas9 (S. pyogenes, catalytically dead)
Analyte sensor: ArsR de-represses Pars on arsenite; MerR activates PmerT on mercury.

Signal flow

Arsenite -> Pars drives the anti-reporter sgRNA. Hg(II) -> PmerT drives dCas9. Only when BOTH metals are present do dCas9 and sgRNA together repress the constitutive reporter (CRISPRi AND). With one or neither metal, the reporter stays ON.

Safe chassis

E. coli K-12 (MG1655) — Escherichia coli

The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.

BSL-1

Genetic parts

Part	Role	Source / id
ArsR + Pars (input 1) Arsenite-responsive; drives the sgRNA.	regulator	E. coli ars operon; Stocker et al. 2003
MerR + PmerT (input 2) Mercury-responsive; drives dCas9.	regulator	Tn21 mer operon
Anti-reporter sgRNA	sgRNA	transcribed from Pars (input 1)
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9 (from PmerT, input 2) Expressed only under mercury.	dCas9	Qi et al. 2013 (CRISPRi)
amilCP reporter Constitutive; repressed only when both inputs present.	reporter	BBa_K592009

Output & readout

Type: pigment
Reporter: amilCP
Readout: Visible pigment (naked eye)
Positive result: Pigment is lost only when both arsenic and mercury are present.

Performance

Device validated: No — design template (parts validated individually)

Both sensing modules and CRISPRi are validated separately; the AND-gate integration is a design template. Requiring two co-contaminants sharply cuts single-analyte false positives.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Lab/contained; add kill-switch for field use.
Field-deployable: Yes (with containment)

E. coli K-12 non-pathogenic BSL-1 host.

Build & run

#	Stage	Step
1	design	Design the AND topology Route input 1 (ArsR/Pars) to the sgRNA and input 2 (MerR/PmerT) to dCas9; check off-targets.
2	assembly	Assemble units TU1: ArsR + Pars -> sgRNA. TU2: MerR + PmerT -> dCas9. TU3: constitutive amilCP.
3	transformation	Transform E. coli K-12 Select; verify pigment-on with each metal alone, pigment-off only with both.
4	induction	Expose to sample Test all four combinations (neither/As/Hg/both) plus standards.
5	readout	Score colour Loss of pigment = both metals present.

Source & parts

Design

Design template: a two-input CRISPRi AND gate combining validated ArsR and MerR metal sensors

Parts validated in

Stocker et al. 2003 (ArsR)
mer operon / MerR literature
Qi et al. 2013, Cell (CRISPRi)

License

Parts per their original sources; design template CC BY 4.0