Arsenic water sensor (ArsR + CRISPRi)
Detects arsenite in drinking water. The validated ArsR/Pars sensing module gates an sgRNA that, with dCas9, represses a constitutive sfGFP reporter (CRISPRi inverter). Built in safe E. coli K-12.
Environmental contaminantBSL-1 chassistemplatearsenicheavy-metalwaterenvironmentalCRISPRifield
Input
Arsenite As(III)
Environmental contaminant
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
sfGFP
fluorescent
What it detects
- Analyte
- Arsenite As(III) — ArsR sensing module responds around the WHO limit of 10 µg/L (~0.13 µM) up to tens of µg/L
- Category
- Environmental contaminant
- Signal
- Inorganic arsenic in drinking/ground water
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- Arsenite binds the ArsR repressor, releasing it from the Pars operator and de-repressing the Pars promoter.
Signal flow
As(III) -> ArsR releases Pars -> Pars transcribes an sgRNA -> sgRNA + dCas9 bind and repress the constitutive sfGFP cassette (CRISPRi) -> green fluorescence falls as arsenic rises (NOT gate). A second CRISPRi inverter stage flips this to signal-ON if a turn-on readout is preferred.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| ArsR repressor Arsenite-responsive transcriptional repressor. | regulator | BBa_J33201 (arsR/Pars module) |
| Pars promoter/operator De-repressed when ArsR binds arsenite. | promoter | BBa_J33201 |
| Anti-sfGFP sgRNA Transcribed from Pars; spacer targets the reporter promoter for CRISPRi knockdown. | sgRNA | designed to target the sfGFP promoter region |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard S. pyogenes sgRNA scaffold (Qi et al. 2013) |
| dCas9 Constitutively expressed; catalytically dead, blocks transcription when guided. | dCas9 | Addgene dCas9 (D10A/H840A); Qi et al. 2013, Cell |
| J23119 constitutive promoter Drives the sfGFP reporter (target of CRISPRi). TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC | promoter | BBa_J23119 |
| B0034 RBS AAAGAGGAGAAA | rbs | BBa_B0034 |
| sfGFP Reporter whose level reports arsenic. | reporter | Pedelacq et al. 2006 |
Output & readout
- Type
- fluorescent
- Reporter
- sfGFP
- Readout
- Green fluorescence (plate reader or field fluorimeter)
- Positive result
- Fluorescence change proportional to arsenic concentration.
Performance
- Limit of detection
- ArsR sensing module is validated near 10 µg/L (WHO arsenic limit).
- Dynamic range
- ~10-100 µg/L for the native ArsR module
- Response time
- ~120 min
- Device validated
- No — design template (parts validated individually)
The ArsR/Pars sensing module and CRISPRi are each individually validated in the literature; this specific integrated CRISPRi device is a design template and has not been validated end to end here.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Lab/contained use; auxotrophic kill-switch recommended before any field deployment.
- Field-deployable
- Yes (with containment)
E. coli K-12 is a non-pathogenic BSL-1 host.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design the anti-reporter sgRNA Pick a 20-nt spacer targeting the sfGFP promoter/5'UTR with a PAM; check off-targets against the host genome. |
| 2 | assembly | Assemble the two transcription units TU1: Pars -> sgRNA. TU2: constitutive dCas9 + J23119-sfGFP reporter. Clone into a SEVA vector. |
| 3 | transformation | Transform E. coli K-12 Transform and select; verify dCas9 and reporter expression in the absence of arsenic. |
| 4 | induction | Expose to sample Incubate cells with the water sample (and an arsenic standard curve). |
| 5 | readout | Measure fluorescence Read sfGFP; interpolate arsenic concentration from the standard curve. |
Source & parts
- Design
- Design template combining a validated ArsR/Pars arsenic-sensing module with a dCas9 CRISPRi reporter circuit
- Parts validated in
- Stocker et al. 2003, Environ. Sci. Technol. (ArsR-based arsenic biosensor)
- iGEM Edinburgh 2006 arsenic biosensor (BBa_J33201)
- Qi et al. 2013, Cell (CRISPRi / dCas9)
- License
- Parts per their original sources; design template CC BY 4.0