Self-powered arsenic sensor (ArsR + CRISPRi)

A self-powered water arsenic sensor. The native cyanobacterial ArsR regulator gates a CRISPRi circuit driving a fluorescent reporter, in photosynthetic Synechocystis — which runs on light and CO2, so it can be deployed long-term without added nutrients.

Environmental contaminantBSL-1 chassistemplatearsenicheavy-metalwaterenvironmentalself-poweredcyanobacteriaCRISPRi

Open in designer Design guide RNA

Input

Arsenite As(III)

Environmental contaminant

→

Sense

CRISPRi-repression

dCas9 (S. pyogenes, catalytically dead)

→

Chassis

Synechocystis sp. PCC 6803

BSL-1

→

Output

sfGFP

fluorescent

What it detects

Analyte: Arsenite As(III) — ArsR responds around the 10 µg/L WHO limit and above
Category: Environmental contaminant
Signal: Inorganic arsenic in water

Genetic circuit

⤢ click to enlarge

Genetic construct (SBOL)

The DNA construct as transcription units, drawn with SBOL Visual part glyphs.

⤢ click to enlarge

CRISPR sensing mechanism

Strategy: CRISPRi-repression · NOT logic
Cas protein: dCas9 (S. pyogenes, catalytically dead)
Analyte sensor: Arsenite binds the cyanobacterial ArsR repressor, de-repressing the ars promoter.

Signal flow

As(III) -> ArsR releases Pars -> anti-reporter sgRNA -> CRISPRi inverts a constitutive reporter (NOT). Pair an inverter for turn-on. Powered by photosynthesis.

Safe chassis

Synechocystis sp. PCC 6803 — Synechocystis sp.

A non-pathogenic photosynthetic cyanobacterium. It runs on light and CO2, so biosensors built in it are self-powered — ideal for long-term, deployable environmental and water-quality monitoring without added nutrients.

BSL-1

Genetic parts

Part	Role	Source / id
ArsR regulator	regulator	Native Synechocystis arsR (ars operon)
Pars promoter	promoter	Synechocystis ars promoter
sgRNA	sgRNA	designed against / upstream of the reporter promoter
sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC	sgRNA	Standard SpCas9 scaffold
dCas9	dCas9	Yao et al. 2016 (CRISPRi in Synechocystis)
sfGFP	reporter	Pedelacq et al. 2006

Output & readout

Type: fluorescent
Reporter: sfGFP
Readout: Green fluorescence (field fluorimeter)
Positive result: Fluorescence change reports arsenic.

Performance

Device validated: No — design template (parts validated individually)

Cyanobacterial ArsR arsenic sensing and Synechocystis CRISPRi are validated separately; integrated device is a design template. Photoautotroph enables self-powered, long-term deployment.

Safety

Biosafety level: BSL-1 (non-pathogenic chassis)
GRAS chassis: No
Biocontainment: Light/CO2-dependent growth; add inducible-essential containment for outdoor use.
Field-deployable: Yes (with containment)

Self-powered (photosynthesis).

Build & run

#	Stage	Step
1	design	Design sgRNA Target/position the sgRNA; check Synechocystis 6803 off-targets.
2	assembly	Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit.
3	transformation	Transform Synechocystis 6803 Transform, select, and confirm low background.
4	induction	Expose to sample Incubate with the sample plus a arsenic standard curve.
5	readout	Read result Relate signal to concentration.

Source & parts

Design

Design template combining the native cyanobacterial ArsR arsenic sensor with Synechocystis CRISPRi

Parts validated in

Cyanobacterial ars / ArsR literature
Yao et al. 2016 (CRISPRi in Synechocystis)

License

Parts per their original sources; design template CC BY 4.0