Androgen sensor (AR + CRISPRa)
Detects androgens (testosterone and anabolic-steroid mimics) in water and sport/clinical samples using the human androgen receptor expressed in GRAS yeast — a eukaryotic sensing class bacteria cannot do — gating a CRISPRa circuit driving a fluorescent reporter.
What it detects
- Analyte
- Androgens (testosterone / mimics) — Yeast androgen screen detects sub-nM to nM DHT/testosterone
- Category
- Chemical / metabolite
- Signal
- Androgenic activity in water, clinical, or anti-doping samples
Genetic circuit
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
CRISPR sensing mechanism
- Strategy
- CRISPRa-activation · amplifier logic
- Cas protein
- dCas9-VPR (eukaryotic CRISPRa activator)
- Analyte sensor
- Ligand-bound human androgen receptor (AR) binds androgen-response elements (AREs), activating an ARE promoter (the yeast androgen screen).
Safe chassis
GRAS baker's yeast — the model eukaryote. Being a eukaryote, it can host human nuclear receptors and GPCRs, unlocking sensing of steroids, hormones, and other eukaryotic-specific ligands that bacteria cannot detect. dCas9 CRISPRi/CRISPRa are well established.
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| Human androgen receptor (AR) | regulator | Human AR; Sohoni & Sumpter 1998 (yeast androgen screen) |
| ARE promoter | promoter | androgen-response-element yeast promoter |
| sgRNA | sgRNA | designed against / upstream of the reporter promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9-VPR | dCas9 | Yeast CRISPRa (dCas9-VPR) |
| yEGFP | reporter | yeast-enhanced GFP |
Output & readout
- Type
- fluorescent
- Reporter
- yEGFP
- Readout
- Green fluorescence (plate reader)
- Positive result
- Fluorescence increases with androgenic activity.
Performance
- Device validated
- No — design template (parts validated individually)
The yeast androgen screen (AR/ARE) is a validated assay; the CRISPRa-amplified version is a design template. Reports total androgenic activity, useful for unknown mixtures.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- Yes
- Biocontainment
- Auxotrophic markers; GRAS yeast host.
- Field-deployable
- Yes (with containment)
GRAS baker's yeast; eukaryotic chassis enables human-receptor sensing.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design sgRNA Target/position the sgRNA; check S. cerevisiae off-targets. |
| 2 | assembly | Assemble units Sensor -> sgRNA; dCas9; reporter. Use the host's standard toolkit. |
| 3 | transformation | Transform S. cerevisiae Transform, select, and confirm low background. |
| 4 | induction | Expose to sample Incubate with the sample plus a androgen standard curve. |
| 5 | readout | Read result Relate signal to concentration. |
Source & parts
- Design
- Design template combining the yeast androgen screen (AR/ARE) with eukaryotic CRISPRa
- Parts validated in
- Sohoni & Sumpter 1998 (yeast androgen screen)
- Yeast dCas9-VPR CRISPRa
- License
- Parts per their original sources; design template CC BY 4.0