Bacterial contamination sensor (AI-2 + CRISPRi)
Flags general bacterial contamination by sensing autoinducer-2 (AI-2), the inter-species quorum signal made by most bacteria. The LsrR/AI-2 system gates a CRISPRi circuit driving a visible pigment, in safe E. coli K-12.
Pathogen signalBSL-1 chassistemplateAI-2quorum-sensingcontaminationpathogenwaterfood-safetyCRISPRi
Input
Autoinducer-2 (AI-2 / DPD)
Pathogen signal
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
E. coli K-12 (MG1655)
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- Autoinducer-2 (AI-2 / DPD) — LsrR/AI-2 system responds from sub-µM AI-2
- Category
- Pathogen signal
- Signal
- AI-2, the universal inter-species quorum signal secreted by a broad range of bacteria — a proxy for general microbial contamination
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- Imported AI-2 is phosphorylated and binds the LsrR repressor, de-repressing the lsr (Plsr) promoter.
Signal flow
AI-2 -> phospho-AI-2 releases LsrR -> Plsr transcribes an anti-pigment sgRNA -> dCas9 + sgRNA repress a constitutive amilCP cassette (CRISPRi) -> pigment fades when bacteria are present (NOT gate); add an inverter for colour-on.Safe chassis
E. coli K-12 (MG1655) — Escherichia coli
The non-pathogenic laboratory workhorse. K-12 strains have lost the ability to colonize the human gut and are the reference BSL-1 host for genetic engineering, with the deepest tooling of any bacterial chassis.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| LsrR repressor + Lsr transport AI-2-responsive repressor; native to E. coli. | regulator | E. coli lsr operon |
| Plsr promoter De-repressed by phospho-AI-2. | promoter | E. coli lsr operon promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | Qi et al. 2013, Cell (CRISPRi) |
| amilCP chromoprotein Naked-eye pigment. | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Colour change indicates bacterial quorum signal in the sample.
Performance
- Limit of detection
- LsrR/AI-2 module: sub-µM AI-2 (module-validated).
- Dynamic range
- ~0.1-10 µM AI-2
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Detects a broad bacterial signal rather than one species; the LsrR AI-2 system and CRISPRi are validated separately and the integrated device is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Safe E. coli K-12 reads a secreted small molecule; no pathogen handled.
- Field-deployable
- Lab / supervised use
Indirect, safe detection of contamination via a quorum signal.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: Plsr -> sgRNA (native Lsr import/LsrR). TU2: dCas9 + constitutive amilCP. |
| 3 | transformation | Transform E. coli K-12 Select; confirm baseline pigment without AI-2. |
| 4 | induction | Add sample Incubate with the water/food sample + AI-2 (DPD) standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the LsrR/AI-2 quorum-sensing module with E. coli CRISPRi
- Parts validated in
- Xavier & Bassler 2005 / E. coli lsr-AI-2 system
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0