Crown-gall sensor (TraR/3OC8-HSL + CRISPRi)
Detects the plant pathogen Agrobacterium tumefaciens via its 3-oxo-C8-HSL quorum signal. The TraR receptor gates a CRISPRi circuit driving a visible pigment, in the soil chassis P. putida KT2440 — for agricultural crown-gall surveillance.
Pathogen signalBSL-1 chassistemplatepathogenAgrobacteriumcrown-gallAHL3OC8-HSLquorum-sensingagriculturesoilCRISPRi
Input
3-oxo-C8-homoserine lactone (3OC8-HSL)
Pathogen signal
→
Sense
CRISPRi-repression
dCas9 (S. pyogenes, catalytically dead)
→
Chassis
Pseudomonas putida KT2440
BSL-1
→
Output
amilCP
pigment
What it detects
- Analyte
- 3-oxo-C8-homoserine lactone (3OC8-HSL) — TraR responds from low nM AHL
- Category
- Pathogen signal
- Signal
- The Ti-plasmid quorum signal of Agrobacterium tumefaciens (cause of crown gall disease)
Genetic circuit
⤢ click to enlarge
Genetic construct (SBOL)
The DNA construct as transcription units, drawn with SBOL Visual part glyphs.
⤢ click to enlarge
CRISPR sensing mechanism
- Strategy
- CRISPRi-repression · NOT logic
- Cas protein
- dCas9 (S. pyogenes, catalytically dead)
- Analyte sensor
- TraR binds 3OC8-HSL and activates the Ptra promoter.
Signal flow
3OC8-HSL -> TraR activates Ptra -> transcribes an anti-pigment sgRNA -> CRISPRi represses a constitutive amilCP cassette -> pigment fades when the pathogen signal is present (NOT). Pair an inverter for colour-on.Safe chassis
Pseudomonas putida KT2440 — Pseudomonas putida
A certified safety-strain soil bacterium with exceptional solvent/stress tolerance and diverse metabolism. The premier chassis for environmental biosensing of pollutants and heavy metals in soil and water.
BSL-1
Genetic parts
| Part | Role | Source / id |
|---|---|---|
| TraR receptor 3OC8-HSL-responsive activator; works in the soil host P. putida. | regulator | Agrobacterium tumefaciens Ti plasmid |
| Ptra promoter Activated by AHL-bound TraR. | promoter | Ti plasmid tra operon promoter |
| Anti-pigment sgRNA | sgRNA | designed against the amilCP promoter |
| sgRNA scaffold (SpCas9) GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC | sgRNA | Standard SpCas9 scaffold |
| dCas9 | dCas9 | CRISPRi (established in P. putida) |
| amilCP chromoprotein | reporter | BBa_K592009 |
Output & readout
- Type
- pigment
- Reporter
- amilCP
- Readout
- Visible pigment (naked eye / smartphone)
- Positive result
- Colour change indicates Agrobacterium quorum signal in soil.
Performance
- Limit of detection
- TraR AHL sensing: low-nM (module-validated).
- Dynamic range
- ~1-1000 nM 3OC8-HSL
- Response time
- ~240 min
- Device validated
- No — design template (parts validated individually)
Senses the pathogen's signal molecule, not the live organism; TraR and CRISPRi are validated separately and integration is a design template.
Safety
- Biosafety level
- BSL-1 (non-pathogenic chassis)
- GRAS chassis
- No
- Biocontainment
- Safe P. putida reads a secreted small molecule; no Agrobacterium culture required.
- Field-deployable
- Yes (with containment)
Soil chassis suited to in-field agricultural surveillance.
Build & run
| # | Stage | Step |
|---|---|---|
| 1 | design | Design anti-pigment sgRNA Target the amilCP promoter; check host off-targets. |
| 2 | assembly | Assemble units TU1: TraR. TU2: Ptra -> sgRNA. TU3: dCas9 + constitutive amilCP. SEVA vectors. |
| 3 | transformation | Transform P. putida KT2440 Electroporate; select; confirm baseline pigment without AHL. |
| 4 | induction | Add sample Incubate with soil eluate + 3OC8-HSL standard curve. |
| 5 | readout | Score colour Compare pigment to the curve. |
Source & parts
- Design
- Design template combining the Agrobacterium TraR/3OC8-HSL quorum module with P. putida CRISPRi
- Parts validated in
- Piper/Farrand / TraR quorum sensing (A. tumefaciens Ti plasmid)
- Qi et al. 2013, Cell (CRISPRi)
- License
- Parts per their original sources; design template CC BY 4.0